English dictionary cookies are used to personalize ads and get web traffic statistics. We also share information about the use of the site with our social media, advertising and analytics partners. See details
Accept
to top

Meaning of f.w.d. in the English dictionary

Dictionary
DICTIONARY
section

PRONUNCIATION OF F.W.D.

f.w.d. play
section

WHAT DOES F.W.D. MEAN IN ENGLISH?

definitionDefinition of f.w.d. in the English dictionary

The definition of f.w.d. in the dictionary is four-wheel drive. Other definition of f.w.d. is front-wheel drive.

section

ENGLISH WORDS THAT BEGIN LIKE F.W.D.

f.w.d.
info
These words share the same root as f.w.d.. Click on the words to load more information.

Synonyms and antonyms of f.w.d. in the English dictionary of synonyms

Synonyms
SYNONYMS
section

WORDS RELATING TO «F.W.D.»

f.w.d. have once generation opportunity pass comprehensive immigration reform building grassroots movement make sure congress fixes hong kong insurance pensions club prestige membership customers provides members array unparalleled privileges clients life policies force with urban wrong wheel drive cars supposed either this configuration that causes uneven weight distribution torque relief usaid horn africa thank visiting campaign public awareness launched partnership council september agency international development concluded archived

Translation of «f.w.d.» into 20 languages

Translator
TRANSLATOR
online translator
translator

TRANSLATION OF F.W.D.

Find out the translation of f.w.d. to 20 languages with our English multilingual translator.
info
The translations of f.w.d. from English to other languages presented in this section have been obtained through automatic statistical translation; where the essential translation unit is the word «f.w.d.» in English.
Chinese Spanish English Hindi Arabic Russian Portuguese French German Japanese Korean Vietnamese Italian Polish Ukrainian Romanian Greek Afrikaans Swedish Norwegian
maps
languages  
zh

Translator English - Chinese

f.w.d.
1,325 millions of speakers
map
map
es

Translator English - Spanish

f.w.d.
550 millions of speakers
map
map
en

Translator English - English

f.w.d.
510 millions of speakers
map
map
hi

Translator English - Hindi

f.w.d.
380 millions of speakers
map
map
ar

Translator English - Arabic

f.w.d.
280 millions of speakers
map
map
ru

Translator English - Russian

f.w.d.
278 millions of speakers
map
map
pt

Translator English - Portuguese

f.w.d.
270 millions of speakers
map
map
fr

Translator English - French

f.w.d.
220 millions of speakers
map
map
de

Translator English - German

f.w.d.
180 millions of speakers
map
map
ja

Translator English - Japanese

f.w.d.
130 millions of speakers
map
map
ko

Translator English - Korean

f.w.d.
85 millions of speakers
map
map
vi

Translator English - Vietnamese

f.w.d.
80 millions of speakers
map
map
it

Translator English - Italian

f.w.d.
65 millions of speakers
map
map
pl

Translator English - Polish

f.w.d.
50 millions of speakers
map
map
uk

Translator English - Ukrainian

f.w.d.
40 millions of speakers
map
map
ro

Translator English - Romanian

f.w.d.
30 millions of speakers
map
map
el

Translator English - Greek

f.w.d.
15 millions of speakers
map
map
af

Translator English - Afrikaans

f.w.d.
14 millions of speakers
map
map
sv

Translator English - Swedish

f.w.d.
10 millions of speakers
map
map
no

Translator English - Norwegian

f.w.d.
5 millions of speakers
map
map

Trends of use of f.w.d.

Trends
TRENDS
section

TENDENCIES OF USE OF THE TERM «F.W.D.»

The term «f.w.d.» is very widely used and occupies the 17.026 position in our list of most widely used terms in the English dictionary.
0
100
FREQUENCY
Very widely used
92
/100
stars
info
The map shown above gives the frequency of use of the term «f.w.d.» in the different countries.
Principal search tendencies and common uses of f.w.d.
info
List of principal searches undertaken by users to access our English online dictionary and most widely used expressions with the word «f.w.d.».
section

FREQUENCY OF USE OF THE TERM «F.W.D.» OVER TIME

info
The graph expresses the annual evolution of the frequency of use of the word «f.w.d.» during the past 500 years. Its implementation is based on analysing how often the term «f.w.d.» appears in digitalised printed sources in English between the year 1500 and the present day.

Examples of use in the English literature, quotes and news about f.w.d.

Examples
EXAMPLES
section

10 ENGLISH BOOKS RELATING TO «F.W.D.»

Discover the use of f.w.d. in the following bibliographical selection. Books relating to f.w.d. and brief extracts from same to provide context of its use in English literature.
1
Fluorescence Microscopy
The first volume deals with instrumentation and techniques for fluorescence microscopy, and includes a chapter on quantification and scanning. The second volume deals with the applications of fluorescence microscopy in many fields.
autorF. W. D. Rost, 1995
Share Fluorescence Microscopy on Facebook Share Fluorescence Microscopy on Google + Share Fluorescence Microscopy on Twitter
2
Quantitative Fluorescence Microscopy
This book is a complete guide to this technique for all biologists. It describes the principles and applications of quantitative fluorescence microscopy and also gives much practical information about the instrumentation required.
autorF. W. D. Rost, 1991
Share Quantitative Fluorescence Microscopy on Facebook Share Quantitative Fluorescence Microscopy on Google + Share Quantitative Fluorescence Microscopy on Twitter
3
American Military Vehicles of World War I: An Illustrated ...
Meanwhile, since the American military brass were still experimenting, FWD had to find its own civilian markets to continue its tentative existence. No assembly line meant that FWD cars and trucks were hand-built one by one, resulting in a ...
autorAlbert Mroz, 2009
Share American Military Vehicles of World War I: An Illustrated ... on Facebook Share American Military Vehicles of World War I: An Illustrated ... on Google + Share American Military Vehicles of World War I: An Illustrated ... on Twitter
4
EMAILS Fwd:FW:: The Difference
The Difference Gerry Gialogo Grindulo. 0'. I 'I . - 1 ' ' . ' I P l A 0 I I I 1 J ,_ 1' ' 9 . n I O O O i '. ' .0 ' . O o O .0 I o O ' .oze..... '7'} .5. TDifference COMMUNICATION GENERATION EMAILS Fwd: FW: THE DIFFERENCE COMMUNICATION ...
autorGerry Gialogo Grindulo, 2010
Share EMAILS Fwd:FW:: The Difference on Facebook Share EMAILS Fwd:FW:: The Difference on Google + Share EMAILS Fwd:FW:: The Difference on Twitter
5
Nondestructive Testing of Pavements and Backcalculation of ...
A device for this purpose is sold by the FWD manufacturer. With periodic calibration of the geophones, using an external, independent reference instrumentation system, the systematic error of each deflection sensor can generally be much ...
autorAlbert Jasper Bush, Gilbert Y. Baladi, 1989
Share Nondestructive Testing of Pavements and Backcalculation of ... on Facebook Share Nondestructive Testing of Pavements and Backcalculation of ... on Google + Share Nondestructive Testing of Pavements and Backcalculation of ... on Twitter
6
IBM Flex System and PureFlex System Network Implementation ...
+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 2 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 8440 P2P 3 (pc65) 128 115!+ FWD DESG 807e-08:17:f4: 33:75:00 8440 P2P 4 (pc65) 128 115!+ FWD DESG 807e-08:17:f4:33:75:00 ...
autorJon Tate, Jure Arzensek, David Cain, 2013
Share IBM Flex System and PureFlex System Network Implementation ... on Facebook Share IBM Flex System and PureFlex System Network Implementation ... on Google + Share IBM Flex System and PureFlex System Network Implementation ... on Twitter
7
Resilient Modulus Testing for Pavement Components
Falling Weight Deflectometer Tests Falling weight deflectometer (FWD) tests were performed at STH 60 to determine the operative elastic moduli of the Grade 2 subbase, bottom ash, and foundry slag. The FWD tests were conducted ...
autorGary N. Durham, W. Allen Marr, William L. DeGroff, 2003
Share Resilient Modulus Testing for Pavement Components on Facebook Share Resilient Modulus Testing for Pavement Components on Google + Share Resilient Modulus Testing for Pavement Components on Twitter
8
Molecular Genetics of Dorsal Spine Reduction in Threespine ...
Table 3-9: Microsatellite Markers Primer Name Sequence Stn42 fwd ACACGCAGCTTGACTGTTCC Stn42 rev GCGTATACGTTACACGCCG Stn45 fwd ACGAGGGTTTGAGTCTCTCC Stn45 rev GTTGTTCAATCCATCCGTCC Stn365 fwd ...
autorBrian Russell Summers, 2008
Share Molecular Genetics of Dorsal Spine Reduction in Threespine ... on Facebook Share Molecular Genetics of Dorsal Spine Reduction in Threespine ... on Google + Share Molecular Genetics of Dorsal Spine Reduction in Threespine ... on Twitter
9
Nondestructive Testing of Pavements and Backcalculation of ...
Consistent placement of the FWD measurement system should be followed, and the placement geometry should be documented. 2. Normalize the measured deflections to a standard FWD load level (e.g., 9000 Ib [40 kN|), and calculate the  ...
autorHarold L. Von Quintus, Albert Jasper Bush, Gilbert Y. Baladi, 1994
Share Nondestructive Testing of Pavements and Backcalculation of ... on Facebook Share Nondestructive Testing of Pavements and Backcalculation of ... on Google + Share Nondestructive Testing of Pavements and Backcalculation of ... on Twitter
10
Popular Science
Maker or Seller Name & Model Hp Transmission type Speed range Impl. lift Wt. ( Ib.) Comments Max. cut ALLIS- CHALMERS 720 19.5 Hydro plus 3-spd. ltd. slip differ. Hydro; ltd. slip. Hydro; ltd. slip. Shuttle Gear Gear Gear 3 ranges, fwd. & rev.
autor
Share Popular Science on Facebook Share Popular Science on Google + Share Popular Science on Twitter
APA
REFERENCE
«ENGLISH DICTIONARY. F.w.d. [online] - Edition 3.3 (Dec 2016). Available <http://englishdictionary.education/en/fwd> »
English dictionary
SEARCH Discover more English words on english dictionary
SEARCH
SEARCH
zoom
Search now from over 300 000 English words and expressions
a    b    c    d    e    f    g    h    i    j    k    l    m    n    o    p    q    r    s    t    u    v    w    x    y    z